Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E078G05
Clone ID E078G05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE078G05
Sequence
GATCCACACGGGGGCTGGTGGGCCTTCTCGCTGTCTTGCCTGGAGTCCTTG
Sequence Type genomic DNA
Unitrap ID UNI5423

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 73905606..73905656 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017756 (Slc12a7) NM_011390 solute carrier family 12, member 7 Gene [Source:MGI Symbol;Acc:MGI:1342283]

 
Come back to gene ENSMUSG00000017756


For any suggestions or comments, please send an email to unitrap@crg.es