Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E078E09
Clone ID E078E09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE078E09
Sequence
GATCTAGAAGCATCCTATTCTAGATGGAAGGAGAGGGAGGAATCCATCCAGTCCCATCCCCATGTTTCAGAATCCAGCTC
TTCACCATCCAG
Sequence Type genomic DNA
Unitrap ID UNI15053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134006613..134006704 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042606 (Hirip3) NM_172746 HIRA interacting protein 3 Gene [Source:MGI (curated);Acc:Hirip3-001]


SPLK-Sequence tag 3SE078E09
Sequence
AGAAGAGCCTTATTGAGAGCTGTTGGGAGCACAGATGTAAGACCTCTCTACAGACCTGGATGCTTAGATGGAATTGTAGG
AGAGTAGTGTGGGGNNTGCTGATTGTTTTGTTAGATCAGGTTTGGTCAGCGAGGAAGAGGAGGACATGAAACAAGAACAG
AAGGGCCAGGTTAGATGAGCTTGCTGGGGCCAAAGACGAGCAAGTACCAGTCAAGGCAGACAGAAAGCAGGTTAAGGAAG
AGAGTGGGAGCAGTGAGGAGGAGGCTGTGCTGCAGAGAGCAAAGGTGGAGGGAAGCACAGGTGCTAACTGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042606


For any suggestions or comments, please send an email to unitrap@crg.es