Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E078E03
Clone ID E078E03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE078E03
Sequence
GATCCTTTATGCTTACTAATTCTTTCCTGGATGTTTTCATCTTTCCATGCATAAACTCTAGAAGTTTTCACTTACTGTAT
CCCTCTCCGTGCCTACTGAAGTTTCTTGGTGATCTCCAGGGCTTCACCACAAACCTAGGAAGAAATTACCATTCTTGCCG
ATGTGGCATTTAACTCCAGAATTCTTCAAGTTAAGAGTCCTAAACTTAAAAGACCAGCCAGCTTTTTTCTTTTCATCTTT
CCCAGCCCCCCAGCCACATCTGTT
Sequence Type genomic DNA
Unitrap ID UNI18390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64018868..64019131 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032400 (Zwilch) NM_026507 Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI (curated);Acc:Zwilch-001]


SPLK-Sequence tag 3SE078E03
Sequence
CATACTTATTTGCTTACATAAATATAGTAAAGAGTCTTGTGCAATATAACAAAAGTTGACCTATCAGGCTTGTTTTTTGT
TTCTAGATCAATTAGGTCAAGTATCAGATCAAAAGATGCGAACTATTCTGATATAACTGTTGGGCTCTTTCAGTAACTAG
AGCTACTTTCCCTATAGCTCAGGCTGGCAATACATTTTGGTAATTTATTTGAGTCGGCCAGTGTTTTATAATTTGTGTAC
TTTGAGATCACTACTAAATGCCTTATGAAGCAGCTGAGCAGTGAAGAGCAGCACTTCTAGTGATCCACAGCTCTCCACAC
AACTCCAGCTGTGGTGACTTCTGGTGATCCACAGCTCTCCACAACTCCAGCTGTGGTGAGAGGGTGCAGTGTCCTATTCT
GGCCTCTAAAGTTACATGCTCACCCCAAATCCCTAATTAAAAGGGCAAATCTCTCTCTCTCTCTCTTTTTTTAATAAGTC
CCAGACTTTTTTCTTCAAGGCAGGGTTTTCCTTTTTAGACCTCACTATCTGGGCCACGACCTGGCTAGAAAC
Sequence Type genomic DNA
Unitrap ID UNI18390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64017937..64018488 544
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032400 (Zwilch) NM_026507 Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI (curated);Acc:Zwilch-001]

 
Come back to gene ENSMUSG00000032400


For any suggestions or comments, please send an email to unitrap@crg.es