Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E078C11
Clone ID E078C11
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE078C11
Sequence
GATCTTGTGGCCCAGAAGTCCCACTTCTTTGTGTGTGAGACAAGCAGAACGCCTTTCAATTTGCCAGATTAATAAGCAAT
CTGTACATAAAGATTGCTGGGTAAGGAGATGGGCAGAGAAATATTAGCTGGCTATGTCTTTAAAGTGACTGTTAAATCCT
CTCTATTTTAATGTAATTTGCTTGGGATATATTGTGTGGTTAAAATAGGTGGCAATCTAGGAATAAAGATTGCAAGACAC
TTAAATTTAGGGCAAAAATCATTGTAACAAGTACATACAATAACATTTGGGGAGGTAAAGAATGTCTTGTGATTGTTTCA
GCTTGCATAGGTTATTTAAAGGCAAAAGT
Sequence Type genomic DNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36055062..36055410 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]


SPLK-Sequence tag 3SE078C11
Sequence
AGTGATTAACATTTTAACTTGATACTTCTTTTAGTGGGTGGTGGATACAGCTAAGAGGGTGGAAAGGTTGGTAAATGTGG
AACTCAGGAGTATAATTTTAAAAGCCATTAGTGCATTTGAATGCTATCTTTCTAGAAGATTGTGTCGTTAAAAGATTTTT
TTTTTCCTCCCTGCTTCAAATATGGCGACTTTTCCTTGCTTGTCCTTTTGTCTTGCAAGCGGCGTTGCAGGTTGTGTCTT
GACCCATTTTTCTCCTGTCCTCCCCCCTCGGTCCTATTTGTTGAGGGGTCCAAGCCCTACCACTTGGCTTTTGTAGGGAG
GATTGGGATGGTCGGCGGTAGTAAGTTGAATTTTAGTTGCAAATTCAAATTCTTATCCCGCAGAAAATTGTATATTAATT
GATTTTATTTTCAGTAATAGGCTCTTAAACTGATTTAAGATAGGTCAAGTTGAGGGTGGTGGTCAAAGGGATGGCT
Sequence Type genomic DNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36055408..36055882 464
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es