Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E077F05
Clone ID E077F05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE077F05
Sequence
CAGGCACATATATTAAGTTGTTGGCATTATTCTTTAGACAGTTAAGCTAACCTGGAATCAAATCTGGTATCTGGTTCTG
Sequence Type genomic DNA
Unitrap ID UNI23013

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4074834..4074911 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005981 (Trap1) NM_026508 TNF receptor-associated protein 1 Gene [Source:MGI (curated);Acc:Trap1-001]

 
Come back to gene ENSMUSG00000005981


For any suggestions or comments, please send an email to unitrap@crg.es