Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E077B05
Clone ID E077B05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE077B05
Sequence
CAGCGATCTAGGTGTGCAATTTGGAAAGTTTTAGTGGAACTATCAGGTTTTTATCACGAAGGTAA
Sequence Type genomic DNA
Unitrap ID UNI513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4965367..4965431 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061374 (Fiz1) NP_001103799 Flt3 interacting zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344336]


SPLK-Sequence tag 3SE077B05
Sequence
TGATTATCGATACATGTGACTTATTTGAAGGAGAAGTTAGGTGGGATTTGGAAGCAAGTCTCAGTGAAGATTTAACTTAG
AA
Sequence Type genomic DNA
Unitrap ID UNI513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4965229..4965310 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061374 (Fiz1) NP_001103799 Flt3 interacting zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344336]

 
Come back to gene ENSMUSG00000061374


For any suggestions or comments, please send an email to unitrap@crg.es