Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E077B04
Clone ID E077B04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE077B04
Sequence
ATTTTATTTAGCATACATTTAGTGATTATTCACAGATTGTAGTACAGCATTGTAATACCCAGATATCATTTCATATATAT
TTATCTTATATCATGTTTATACCTTAAACCCATTAAACTTGTTTAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI11446

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96127251..96127380 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032411 (Tfdp2) NM_178667 transcription factor Dp 2 Gene [Source:MGI Symbol;Acc:MGI:107167]

 
Come back to gene ENSMUSG00000032411


For any suggestions or comments, please send an email to unitrap@crg.es