Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E076G12
Clone ID E076G12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE076G12
Sequence
TAAGAGCGCTACATTTTGTCTGCTTTCAATGTCACCTAGAAACATTTGTGAGTGGTAAGTGGTGAGTACTGAAAGCAGAA
GGGTGAAGGAAAATGTAGAAAATAATTACAGATTTGCCCTCATTCAGAGGTAAGCAGTAGGTTAGAGT
Sequence Type genomic DNA
Unitrap ID UNI13636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107934016..107934163 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032594 (Ihpk1) NM_013785 inositol hexaphosphate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1351633]


SPLK-Sequence tag 3SE076G12
Sequence
ACATTCAGGACGGTGTTGGAGTCCTTGTTAGGGTCCAAGAATCACTGAAGGAATTAGGGGAATTCTAGGGAGGGGTAGGT
GACCTTTATCCTGATTGGTTGGCTCTGTCTCTAAGGGTTTCTGTACCACCATCCGGGTGGCATCCTTT
Sequence Type genomic DNA
Unitrap ID UNI20392

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107934595..107934742 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032594 (Ihpk1) NM_013785 inositol hexaphosphate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1351633]

 
Come back to gene ENSMUSG00000032594


For any suggestions or comments, please send an email to unitrap@crg.es