Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E076D11
Clone ID E076D11
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE076D11
Sequence
GACCCCGTACTTCCCGGTGTGTGTTTAACTTTGAACTGGGATTGGCCAATCGAGAAGGCNNTNNNCGCCCAGAAATCTTG
TTCAAACTTCAATTTCATTCTTTGACTGGGCTTTTAACCTCCGCTTCAGAATCAATCGGCATCCAATTCCGGGGAACCGA
AATTTCAATTCCGGAAGGACTCGGACACGGTAAACGGAAGTGAACCGCAGCTCGCCTCCGTCTCTTCCGGTGTGGCTTCG
TGCGGCCCCCTTCTCTTTTTCTCGGTAGTAGCAGGCCGGCTGGGCGGGTTCTGGTGAGGCTAGGTAAGGGGATGGGCGGT
GGCGGAGGTGGGGAGTGAGGCCTGGGTGTGGCCTCCATGGCGACTCCGCTGGTTCCCAGGCCGCGAGTCTCGCCCCGTTG
CTTCTCAGAGGCTAGGGCCCTGCACTTCTCAGGTCCCGGCCGGGGGCCATTTCATCGGAACGATATTTGAGCTCCCCGTG
CCTTCGAATGTAGCCCTTGCTGCCTCGAACGCCTTTAAGGTAATCGTACAAAATTTTTGCCTTCCAGAAAGAAGGATTTC
GGCCGTTGGAATCTGTCTTCGCGCCCCATCGCTCCAGGAACCTGGCCATCCCGCTTCATTGTGAGCAGTGGGTGGAATTT
GATGGAGCAGGAAAGTCCCAGGGTGAGTAGCTTCTGTCCGTTCTCAT
Sequence Type genomic DNA
Unitrap ID UNI3444

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20263966..20264652 671
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063108 (Zfp26) NM_011753 zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]

 
Come back to gene ENSMUSG00000063108


For any suggestions or comments, please send an email to unitrap@crg.es