Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ex200
Clone ID Ex200
Vector pGT1tfr
Project baygenomics

Sequence tag Ex200
Sequence
CACGTAGACACCTGCAGGAGACGCCTTAAGTCAACTCATGAACGGCCCCATCAAAAAGAAGCTCAAAATTATCCCTGAGG
ATATCTCCTGGGGAG
Sequence Type mRNA
Unitrap ID UNI10315

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88794762..88794852 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es