Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E072A06
Clone ID E072A06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE072A06
Sequence
GATCTTTTGTAGTCAAAATTGGGAACTCTTGCATGAAATAAAATTCTATATGCATCTTCTTTCTCGGATTTCTCGGACTT
TCAAATCCTCCTGTGACAAAGGAATGATT
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84843953..84844061 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es