Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E071G09
Clone ID E071G09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE071G09
Sequence
GTTATGAAACACAATATGGAGAGGGGAAGGGGGTACCTTTGGAGGGCCCATGCCAAGGAGTGCCCCTGTAATGACGCCAT
GCAACAGACCTGGTGTGTATATAAGAGGTTCACTGGGGGACGGGAGAGGAAAAAGGGCCTGGGAAGGGATAGAGACAGAT
AAGTGGACATGTAGAGACAGATGGGAGCAGA
Sequence Type genomic DNA
Unitrap ID UNI22725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71117985..71118175 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es