Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E070H06
Clone ID E070H06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE070H06
Sequence
TAGATACTTTCAAGATTTATTATTTATTCATGT
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108512278..108512310 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 3SE070H06
Sequence
TCTCTGGTCAATTATAAGAGCAGTATCTGCGTCTAGCCACTGAGCTGTATAGTAGTTTTCTTGATTGGTTTTTGGTAGTT
GCTTTTTTTTTTACCACATGGTTTCTCTTTAGCCTTGGATCATCTGGGTCAGGCTGGCCTGGATTAAAGGTGTGTGGCAC
TGCTTCCCAGCTGGAAACTAA
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108512428..108512608 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es