Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E070C11
Clone ID E070C11
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE070C11
Sequence
GGTCCTCCCGGGTCAGCATTGTGCTAATGGTGGCTCCAAATGCTGGTCACTGCAGAGATTGTGGAAAGGTGCATCTGGGT
TCCGCTTGTCGGCTCTTTTAAAAACTGACACCTTCTGC
Sequence Type genomic DNA
Unitrap ID UNI29780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34916858..34916975 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


SPLK-Sequence tag 3SE070C11
Sequence
GCCCCAAGAGAAAAAGCCAGCTATGTCCACGGATGGTAGTAATGAGGTGGTCGTGGAACTTCCTGGAGATGGGGCTTGCC
TTTCCTCTCTGTTTTATCGTTCAGACCTCTTCCTAAAAACACTTCGTTTTTATAATTCAGTTCCTGGTTCAAGGTATTTG
GTAGATGAGTTGTGTTTGTTTTATGCACACCCATCTTAAAAATAAATATTTTGGTTCACCTGAAACTGCTGTTGTTTTGA
CCATGATTTTAGGCCTAACGTTGTTAAACTCCCAAAGACCAAGAACAAAGCTAAAATCTGTCTATGCATAACTGCTCAAG
AATTTCAGAGAGATTGTGTGTTTGTCAAAAGTGGGTTGAAATCTCAGTCGGGATAGGAACTAGATTGCTAAGGG
Sequence Type genomic DNA
Unitrap ID UNI29780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34916974..34917368 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es