Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E069H02
Clone ID E069H02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE069H02
Sequence
GATCTTGGGGTTTTCAGAAAGAAGCATATGAAATGGAATGGGCAGGAGAAAAGATTCTGTCTTTTGTATCACTAGATTAC
AAGGTATTTTATTCCAAGAATTTGACCCAAAATATTCAAAATAAAACATGTGATCGCTGTAGATAGTACCAAGAGCCTGT
GTACAGATGTGGGTGCAGCTGGTGTGCATAACCAGTATCTTCCAAGTTGGATTCTGAGACTTTTCAAGTGACATTTACTA
CTAGTAGACTTCTCTGCTAGTTTAATGGCAGTAAACTACTAAGGTGGATATCACTCTGGGGCCTGTTCACTCACTAATTC
TGTTTATTCTTCCCTTGTATTTGTACTAAAGTCTGAAAGGGAAAGGCTCTTTCCAGCCAATATTATAAAGCAGGAGCTGT
GGGCCAGAAGCGAGAGACATGGCATTCATCCACCAGTTTTGTTTTTAAGCTTCCAAACTTGGTTAGTTGGGGGAAAGGAC
TGCCTTACATATTCCCTGTGTGTTGGTGCTTTGTTGTAAGGCTGTAGCTGCTGGTAAATAAATCAGTTGTTCAAAGTGTG
TTTTATTTTTGTTTTGTAGTCTCCTCTAAGCCATGACCTCATCCTT
Sequence Type genomic DNA
Unitrap ID UNI6229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107757803..107758408 606
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es