Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ex256
Clone ID Ex256
Vector pGT1tfr
Project baygenomics

Sequence tag Ex256
Sequence
CACATTGGCAGGTAACGAGCGGCGGCGGCGGCGGGTCCCGAGTCCAACAGAGCAGCAGCG
Sequence Type mRNA
Unitrap ID UNI4705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41222073..41222133 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es