Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E068H10
Clone ID E068H10
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE068H10
Sequence
AGGTTTTTATTTTTGAGCAGATAGGGTTTCACTATTTAGCTGAGGCTCTGTGTGTTGAAATAGTTGAAACTGTATAGTTA
ATAGATACTGGGTTGCCAAAATTTTACTACCAGTCTTTGGTGGGATTACATAGTAGGGGTAACATATTAAGTAA
Sequence Type genomic DNA
Unitrap ID UNI4145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44421405..44421558 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032097 (Ddx6) NM_007841 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]


SPLK-Sequence tag 3SE068H10
Sequence
GTTATTTTGTTTTCTTTTTCCAGACAGGNGTTTTCCTGTGTAGCCCTGGTTGTCCTGAAACTAGCTCTGTAGACCAGGCT
GACTTGGAACACACAGAG
Sequence Type genomic DNA
Unitrap ID UNI4145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44421586..44421682 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032097 (Ddx6) NM_007841 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]

 
Come back to gene ENSMUSG00000032097


For any suggestions or comments, please send an email to unitrap@crg.es