Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E068G10
Clone ID E068G10
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE068G10
Sequence
GGGATTGGTCAGTTTGAAGACAAGATGGCTGATTAATTCACAACAGTTGTGTGACCTGTCCAGATCAGGCCTTGAGGTTG
TTGAGCCAGTCCACCAGCAGGGGGCCTGCTTGTGGGAGACAAGGCTTTTGTTTGTGTCAGAGGAGGCTGAGGAAGAAGCC
AGTCATCTTGGAGACTCACTACCTTTATTACCTAGTCACGGCCCCTCTCCGTGTGTCTCCCACCAGGGAGTCTGTCTAGC
TCCTAGTCTCTCACTAGGTTTGAACCTAGTATGACAAGCGTGCTAGGCAAGTGCCTTCCCACTCAACTAAAACCTCCGCC
CAGGGCATGCTTTATGCAGTCTTTGGAAAATCAAACTTTTAGTGACCTCCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE068G10
Sequence
CTAGCATGTGCTGGGCACTGTGGGTGCNNNTGACCCAGCCGGTCCTGGACGTGTATGGGGTCACTTTGTGACTGACTTGG
GTTT
Sequence Type genomic DNA
Unitrap ID UNI7776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134800128..134800210 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037242 (Clic4) NM_013885 chloride intracellular channel 4 (mitochondrial) Gene [Source:MGI (curated);Acc:Clic4-001]

 
Come back to gene ENSMUSG00000037242


For any suggestions or comments, please send an email to unitrap@crg.es