Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E068G08
Clone ID E068G08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE068G08
Sequence
TCATTAGTATTTTGAAGCCCATTAGATGTCAAATCCCTGGGGCCTAGAGATTATTTGATAGATGGTGAAGACAGAAAGCA
GACCTTTCAGAGNNNNATGGTTCTTCACCACAAAGGTGCACAAAGCTGTTTTGCTGCCTTGCTTTTACTGATGCTATGAA
AAATACATATCCTGCAAAGGGCTATAGTCAGTGTTGATACTAACATTTCCAGATTAATCTCCCCCATACCCCTGTAGTTG
AACTAGGACATCGGCAAGCATTCTACTACTGAGCTGTTCCTCTGAAAATGTTTTATTTTGTTTTGTTTTTAAATAGTACT
AGATATTGAATATAAGACCTGGCTGTGCTGGAATTGCAAGTGTGTAAGTGCCAACTTTCCTAGTTGCAGCTGCTGTTTGG
TTGAAATTATGTAG
Sequence Type genomic DNA
Unitrap ID UNI21564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6215619..6216032 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025907 (Rb1cc1) NM_009826 RB1-inducible coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1341850]


SPLK-Sequence tag 3SE068G08
Sequence
AGTGAAGCTGCCAATCTTGGAACTCACNNNTAGTGATCCTAAGTGACTCCTCACAGCTGCCAGTCAGTGGATGAAAGCAC
AGGCTTCCATAGCTAAGGAGCTCAGGGATGCTTCTCAATAG
Sequence Type genomic DNA
Unitrap ID UNI21564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6216388..6216507 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025907 (Rb1cc1) NM_009826 RB1-inducible coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1341850]

 
Come back to gene ENSMUSG00000025907


For any suggestions or comments, please send an email to unitrap@crg.es