Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E068E08
Clone ID E068E08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE068E08
Sequence
TTGCCTGCTGTGTTTTCTGTGCCCGGAGCTGCTCCTGCAGCCCCTCTCCTAAGATGCACTTAGGACGAGTGAGAAGTCAG
CACGTGGTGCCGCTTCTCCGGGCTGCGACTCTCGGGAAACTAAGAAGTAAAATTGCCTTTTTGAGGATGGTAGGTGGATG
TATGTACAAGGCAGGTGAGGTCGGTCTGGTGAGGCCACCTTT
Sequence Type genomic DNA
Unitrap ID UNI5233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122435284..122435485 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]


SPLK-Sequence tag 3SE068E08
Sequence
CTTTGAAGACGATCGTCTTTTTATTTGATCTTTCTCTTGGTCCACGATCGCCTCTAACTTAAGATTTTTTTTTTCCCCAA
TCCCACCCGGGGGCGTGGCAGGCAAAACCCCCCAGGGGCTTTGGAAAGGTTTAAGAAACGGTGGCAAAAGGGAATTAAAC
CCCCGAAACGGTTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es