Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E068E04
Clone ID E068E04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE068E04
Sequence
GATCCGCATCAGCACCCCCAGGGTTTACCCCATCATGTAGGAAGACATGGCCCAAGACAAGCAGGAAATGATGTTTGTGC
TGACATTTCTTCCACTTAGAAAATCAATATTCTGTGGTCTGCCTAATTGCTCTGTTGCTGCTAAATGAGTCATTATGGAA
GGAAAATAGCAAACGCATTGTGAGATTAATGGGAGAAAATAGTTGGCAAATGACTTTGGTTTGCTTCCGAAACTCTGAGA
AGGTGTTACTATGAGAAATCTGGAGAGTCGTACAAGGCTAAGTTTCAGGCCAAAGGGAATCAGCAGCTATTGGGTGGTGA
GAGGTCTGAGATTCCTGCTGGGTAGGACACTTCGGGGACTGGAGCCTTACAGCAGCATAGGCACTTTGATGGTCTGCTCT
TGAGGGAAGGGGCACTGTTCAGGTATAGTTATTTGTCAGGCATCAAGCGAGGTGGGAAGATG
Sequence Type genomic DNA
Unitrap ID UNI29787

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35530048..35530509 462
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026883 (Dab2ip) NM_001001602 disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI (curated);Acc:Dab2ip-002]


SPLK-Sequence tag 3SE068E04
Sequence
AACATCCTGGGCAGGTACTAGAGCTTATGCGTCTCCCTTGGTCTGACAGCCTAGGAAGCATGCTTTTTACCAGTATGGCC
ACCTCGGCTGACGACAGCTAATGACTGACACAGCCCTTTCTGACCGGCTGGCTTTAGACCTGGGCCTGTATATCCCCTGG
TCCAGAGTGATGCTCCTCTGCTGCAGGAGGCTGGCACCTGCAGGTGCATCTGCCACTAGAGTCAAGAACTTCATTCCTGC
AACAGGACTGGCAGTTAGCTGCCCACGACTGTTGAACTGGGGGTCTGTAGGATGTGCCAGTAAAGTGTTGACCTCAATAT
CCCCAAACCAGACTTTTCTTCCTTACTAGGTCTTTGCTTCCTCTGACAGTTTTGTGATGTTATAAATTCCAAGTGTATTA
AGGAGTCTTGAAAAGGCTCTGTATGTAACATGTTTCCCCCTCCCATGAGGCCTATTGGTTTACTCCTTTTGAGTACCCCA
GCTCACCTNNGGCTGTCTGTCTGTCTGCAGAGGTGGTGGAGGCGGTGTGGTCTGCTGATTATGGCTGGAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026883


For any suggestions or comments, please send an email to unitrap@crg.es