Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E068C05
Clone ID E068C05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE068C05
Sequence
GATCTGAGTCAGAGGTAGCAGAGATGTGGGAAACCCAGCCAGGACAGGGTAAAGGGTGTCTATGCCTTTGGACTGAGTCC
CTGTAGCAGCTTGTGTGAAAGTCTGTGTGCTAATAGGTCAGCTGAAATAAATATATGACAGACTGATGTTACCTAGCAAC
AGAAGACAGGAGGCGG
Sequence Type genomic DNA
Unitrap ID UNI14457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102934470..102934645 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]


SPLK-Sequence tag 3SE068C05
Sequence
GCGGGAACTAGCTTCCAGTGTGTNNNGTGAATTGGTTCCTGTCTAGACTTGTAAATGCACTTTTTAATAATGGGGTGCTG
TTCTGATTCT
Sequence Type genomic DNA
Unitrap ID UNI14457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102934642..102934730 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es