Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone LST022
Clone ID LST022
Vector pGT2TMpfs
Project baygenomics

Sequence tag LST022
Sequence
TAGCTGGCGAGCAGGCATGCCACGGCTCCTGACGCCCTTGCTCTGCCTAACGCTGCTGCCCGCGCTCGCCGCAAGAGGCT
TGAGATGCTCCCAGCCAAGTGGGACCTGCCTGAATGGAGGGAGGTGCGAAGTGGCCAACGGCACTGAAGCCTGTGT
Sequence Type mRNA
Unitrap ID UNI10323

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26357401..26359093 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026923 (Notch1) NM_008714 Notch gene homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Notch1-001]

 
Come back to gene ENSMUSG00000026923


For any suggestions or comments, please send an email to unitrap@crg.es