Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E068B08
Clone ID E068B08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE068B08
Sequence
TAATAAAAGAAAAATAAACGGGTGGGGGAATGGCTGAGGGGCTAGAGCTTCAGACAGAACTAAATGTGCTTTAACCTTTG
AACTAGGGAAAGC
Sequence Type genomic DNA
Unitrap ID UNI10776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73646448..73646540 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es