Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E068A08
Clone ID E068A08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE068A08
Sequence
GTAAGAATAAATACAAAGTTGATCAATGTTCTAGAAAAACGATTAGTTAAAAAATAAGTATATAACAATATTAGGATGTC
CTTCATTTTTGTGTAGGAGAAAAGCATTGCTGTACTGAGTGTTACAGATATACTTAGTGG
Sequence Type genomic DNA
Unitrap ID UNI29790

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11843188..11843327 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]


SPLK-Sequence tag 3SE068A08
Sequence
CAGGACGTAGGGTCAGATTTTGTTCTTCGCCATTTCTTGGACACAGGACTGTACTAGAGGGTTAGAAAGTTGTAACAGTT
ACCTACTTCTCCTATTCTCCCTCCTTTTCTGAAAGTTTCTTAAACTGATGTAAAAATTCCCCCCACAAAAATGTCTTGCT
GAGTCAGCAAAAGAGCCTGTCATTGTGGTTGCTTTGGTTTTAAATTACCTACCCTGAAAAGGCAATTAGGTTCATGTTCT
GCAAGACAGCAGACCACCAAGAGGCATGAGGAGCCTCCTCTGCAAAAGCACTTTGACAGTAGGACCAGCATGTTGGAAAC
AAAGAAGAAATTCAGGGCAGTGCTCTGAAGCAGCTAAATGCAGGAATCAAAGTCCCTCTCAGCAGTGAGAAGGTTATGTA
GAACAAAAGACTGCACTGGGTGTAAAGAGGTCAGAGAAGCCTTGCCCTGCCTAGCCCGCCCAACACGAAAACTGCTAGGG
AGAGTGCAGACTAAGAACCACAGAATGACTTGGGTAGCTTAGTGTCCTCTGCCTCTCCTTAAGAGATC
Sequence Type genomic DNA
Unitrap ID UNI29790

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11842635..11843181 542
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es