Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E067H05
Clone ID E067H05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE067H05
Sequence
TGTGTGTGCGCGTGTGTGTATACATATATTTATCATTAGAGGGCTCAACCCTTAACTTTTTATTGGGAAGTACACAATGA
GCCATTGTGACATTGTTTATCTCAGGATATCTGTAAATCTTTAAAAAAAACCATATATA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE067H05
Sequence
CATTGTAAAAAATGTAATCATATGTCTAAATATGGCATTAAAAATAATTTTTCT
Sequence Type genomic DNA
Unitrap ID UNI4014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35508542..35508595 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es