Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E067E02
Clone ID E067E02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE067E02
Sequence
GATCTCGGGGGACTTTTCCCCCTCTGCCCGCAAGAGGGACCCGTAAGATGAAAAGCGTTTCAAACACGGTCGGTCCGGAG
TTAGGGAAAAAAAGAAAAGAAAGAAAAATAAACAACAGAGTGAGACCCTCGGTCTGAGTACCGCTCCATCCATTCATGCG
CTCAACTATTCAAACTGCCGGATGGTCGTGAGGGGTCCCGAGGGAATTCCATCCTTGAAAGTATGAGTTGGG
Sequence Type genomic DNA
Unitrap ID UNI16694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131136100..131136331 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045427 (Hnrph2) NM_019868 heterogeneous nuclear ribonucleoprotein H2 Gene [Source:MGI (curated);Acc:Hnrph2-001]

 
Come back to gene ENSMUSG00000045427


For any suggestions or comments, please send an email to unitrap@crg.es