Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone LST050
Clone ID LST050
Vector pGT2TMpfs
Project baygenomics

Sequence tag LST050
Sequence
TGAGGCACTGTCGGGCCCGCTGCCCTCCGACATCTCCAGCCT
Sequence Type mRNA
Unitrap ID UNI10326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104315379..104315417 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032913 (Lrig2) NM_001025067 leucine-rich repeats and immunoglobulin-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:2443718]

 
Come back to gene ENSMUSG00000032913


For any suggestions or comments, please send an email to unitrap@crg.es