Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E067B05
Clone ID E067B05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE067B05
Sequence
GAGGCCTTTGCACCGGGATGCTGTTAAAACTTAACAATTTGCATACGGGGGTGGGGGTGGGAGAAAAACAAACTGGGGAA
AGAGAGGTGTTTTTTGGTTTTTGTTTTTTAAATTTATACTGGTTGTTTGTATTTTCCACGCAAAGAATTTCAAAACTAAC
AACCACCACCTCGAGCTTCGGAAGAAAAGACCCTTGCTAGTTCTTCGCTTTGAGTCTAGAGCTGGAATTTTTAATAGTTA
AGGCTTCTCATAAAGCGATAGCATTAAAGGAGTTCACTGCCTCTTACTATTATTATTTATTAGTACAATTTTTTTTTAGT
TTATTTGAGCTTTGAGGTAAGTTAATTAAGGAACTGAATCAAG
Sequence Type genomic DNA
Unitrap ID UNI6239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91564221..91564584 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]


SPLK-Sequence tag 3SE067B05
Sequence
GTGAGAGAATACAGAGGAAAGTGCATGACACAGCTCACGTTTGCTTTTAAAAGTCGACTCATCTGCAACGAGTCCAGCCA
TCTCCATCCATTTCCCTACCCAGAACAGAACATGTGACTGAGGAGCCGCTGCTGTTGGGCGTTTGGTGGGT
Sequence Type genomic DNA
Unitrap ID UNI6239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91563722..91563873 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]

 
Come back to gene ENSMUSG00000031665


For any suggestions or comments, please send an email to unitrap@crg.es