Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E066F10
Clone ID E066F10
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE066F10
Sequence
ACCTGTCAGCTTTTGGCATCTGAGACATTTTCTTTTGTAATGGAACATTAATTATATATAGACCCAATGTGTCTAAAAGG
AGGAGAGAGCAGGGATGCTAACTCTGGACGATGCTCAAACCAAATTTGGTACTGTTGATGTAAAGCTCTCAACAGACA
Sequence Type genomic DNA
Unitrap ID UNI18012

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30961017..30961174 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es