Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E066F08
Clone ID E066F08
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE066F08
Sequence
GACCTCAGCATCCTTGAACAAGCTGTCTTTACAGGATGGACATAAAGCCAAAAAACCAGCATGTAAATTTGAAGAGGGTC
AAGATGTCTTAGCTAGATGGTCAGATGGCTTGTTTTATCTTGGAACTATCAAAAAGGCAAGTTACCTTAATAAATTTCTG
CTATACTTGCATTACT
Sequence Type genomic DNA
Unitrap ID UNI17974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509907..108510082 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 3SE066F08
Sequence
ACTGATTTCTTGTGTATTGCAGATAAACATATTGAAACAGAGCTGCTTCATCATATTTGAGGACAGTTCCAAATCCTGGG
TTCTCTGGAAGGACATCCAAACAGGCAGGTGCTATGTTACTCTTGAACATGATTGATATCGAAACTTAGTTTTCTTCAAC
ATGACTTTTTCTGATGCCAGTGATACTGAATATACTGTTCTTCAGTGGCTGGGTAGCATGTATAAGACG
Sequence Type genomic DNA
Unitrap ID UNI17974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108510134..108510362 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es