Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E066D02
Clone ID E066D02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE066D02
Sequence
TCTGCAGGGTTCTTGAAGGGGTCAGCTTCACCACTTGGCTACAGACACCTATGGTGACTTCAGGTGAACCTGTGGTCACA
CCCCACGCAGCCAAATGCATGTCAGAGGCGTTTGCATGCAGACGTGGGAAGAGCTGTGGATGAGGAGGCGGAGGCTGATC
TAACGAAGTGGTTGCCAAGCTCATATCTGACGGATGAGGAGGCATAACTCAGAATGAGTAATGGCTGAGGTAGCCCAGGC
AGAAAGAGCTACCTCAGTTGATGCCTCAGGGTACGGTAGCGACCTACCACTGAGTTTAAGATGTCAGGCCCTCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE066D02
Sequence
TCTGCTTCTCACTGACTTTGCCGACATCTGGTGCTCTCTCTCTTTCTTCTGTCTCTTTCCACTCCGATTTAAC
Sequence Type genomic DNA
Unitrap ID UNI8333

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28406908..28406981 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002250 (Ppard) NM_011145 peroxisome proliferator activator receptor delta Gene [Source:MGI (curated);Acc:Ppard-001]

 
Come back to gene ENSMUSG00000002250


For any suggestions or comments, please send an email to unitrap@crg.es