Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E065H03
Clone ID E065H03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE065H03
Sequence
ACTCCCAACTGCCCCCTCCCCATTTAGCCTATTTGATGCTCTCTTGCCTTAGTAACTTCCACACCACCACGTTCTCTCTG
GTTTCTTAGGTTTCTGAGGTACT
Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62243990..62244092 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


SPLK-Sequence tag 3SE065H03
Sequence
GCAAGTTTTAATGCTTACATTTTTCTCCATAGTTATATAAATTTCCATTATCCACTCATGAAATGATAAACATTTGGGCG
GGC
Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62243611..62243693 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es