Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E065E04
Clone ID E065E04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE065E04
Sequence
GATCTGTGGGGGCATTTGGAAAGATACGACTCTTTCTCATCAGCACTTTTGATATGATTATTTATAGTTCTTCCTTTCCA
GTAACACACCCGGGCTTAACCCTGAGCAACAACAAC
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165703714..165703829 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


SPLK-Sequence tag 3SE065E04
Sequence
CCGAGATTGTGGTGTGGGCAAAGGGTAGGCCCTCAGATGTGGCTGTTCAAAATGACTAGTTTTGAATTTTGGTCTTTGCT
TTTGTAAACCAAGTATTCTTTCTTTCTCTTCCCCCACCCCCTTTAAATTCAGACACTGCAATCGTCAATGTAGTCAAATA
CAAGTTGTGCACTTATGCGTGCATGTGTGATGTGTGAGTGTGTGTGTACACATGTACTCGCACAGATGGGGGTTGCCTTT
GAAGGGATGGCTTGCAGTTGTGGGAAAAAGATGGTTTTCCTCAGTAGTGCTGGAAGATTCTAGGCTCAAAAATTGATGGT
GCTGTTGCTAAGTCAGGTGGCTGTGGCGGTCACTTGTGATGCTTGGGGAGATGAAACAGCTTACCCCCCACTTCTGTTTC
AGAATTGATTATCTTAAACTCAGCAGCCACCACGAAACTGCTTTGCATTTTCCTTGCTTCTCAGCTGCATTCCTGCCTGA
AGTATTCAGCCACGTAATTGTTCTCTTCAGTGCGGGTCCTCTTCCTTGATCAATACACCTTTGACTGTTTCCATCATAGC
NNAAATCCCTTCAGTGGGTCTCCAGTCTTTTGTG
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165703086..165703679 578
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es