Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E064F05
Clone ID E064F05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE064F05
Sequence
CACACACAGGGCATGTGCCTGCATGTGCGCCTTGTGTTTTCATATGTAAGTTTTATGGTGTTTACATCTAGAACATAAGC
CTAAACACTACCAAACTAGACACTACTGAGAACCCACTGACCACTAGATACAGCCTTCACCTCCCTGAAAGTCTGGGCCA
CACACCCCTGTACATGTTGGCTTTGCATTTGCCCTACTTTTGAGGCTGCAGCTAGAATCTTAAAGTCCTCACCTTCAGGG
TCCCTGTGGAAGAACGACACATGTAGCGACACCAGTGAGACCCAGTCAGGCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE064F05
Sequence
GCTGCATGGAAGGGCTGCCTCTGAGCAGTGGTTATCCTAGGCCAACGGCACAGACTCTTGACTTTTTTTCTTCTAGTGTT
CAGGCAGCTGAAGCTTTGACATCAGTTGAAAAAGGTTCACTTAGTAAAGAGAGACGGACTAAATTATCAACTGGGCAGTC
TGTGTGGGGCAGGCCGGTGTCGCCGAGTCAAACACAGGTGGGGTATAATGTTCTTTAAGCAGTGCCTTGGCCGCACACAA
GTTCTGTTACTCTCTTTATTCTTATCTCCTTGCTGTAAGTGGAAATTACAAACTGAGTTTCTTGAGGCCTCTGCAG
Sequence Type genomic DNA
Unitrap ID UNI29535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165707877..165708192 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es