Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E063D12
Clone ID E063D12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE063D12
Sequence
CTAATCTGTTTTACTGAAAAAGGTGCTGTCTTTTTGGTGTGTGTATGTCTTAGTTTACATCTCTTTCCTTAGCTCCATCC
CAGTAGAGGCT
Sequence Type genomic DNA
Unitrap ID UNI15046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93827491..93827581 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037601 (Nme1) NM_008704 non-metastatic cells 1, protein (NM23A) expressed in Gene [Source:MGI (curated);Acc:Nme1-001]

 
Come back to gene ENSMUSG00000037601


For any suggestions or comments, please send an email to unitrap@crg.es