Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E063D02
Clone ID E063D02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE063D02
Sequence
GATCCAAGGGGACGTTGAGCGGAAGAGGTGGCAGGCTCCGCAGTATGAGTAGAGGCGTGGGGACTGCATGGTATGCTAGG
TATATATGAGGAGAAGGGCTTGGGG
Sequence Type genomic DNA
Unitrap ID UNI29804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26276174..26276278 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024182 (Axin1) NM_009733 axin 1 Gene [Source:MGI (curated);Acc:Axin1-001]

 
Come back to gene ENSMUSG00000024182


For any suggestions or comments, please send an email to unitrap@crg.es