Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E062F12
Clone ID E062F12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE062F12
Sequence
ATGAAAGCACAAACAACAATTGCCTAGTTATATTTTGTTCCTAAAAGAAAAATAACCATGCTAGTTAGAAGCTTAAATTA
ATGGGGCCAGTTATTAGCCCCTCTTACTTGGACTCAAAACACAGAGGCAGGATATTTCAAGATTGGCTACCTCAGCATGA
ATTCAGGCTCTTTCCAGAACATTCTCATCATTTACAGTAAATCAATGTACTTAGAGCTGTCTTTCTTAACATCATGTGGC
AGCTGTTTGAGTCACAGGTATGACATCATAGGATAAGTTAAAGGCGACTCTGAGTGG
Sequence Type genomic DNA
Unitrap ID UNI12892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84311756..84312052 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027082 (Tfpi) NM_011576 tissue factor pathway inhibitor Gene [Source:MGI (curated);Acc:Tfpi-001]

 
Come back to gene ENSMUSG00000027082


For any suggestions or comments, please send an email to unitrap@crg.es