Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E062D02
Clone ID E062D02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE062D02
Sequence
GATCTATTTGCTTCCAGAATTGTGAAATTACCTTGGTTGGTTCATGGAAGGTTT
Sequence Type genomic DNA
Unitrap ID UNI29809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24807617..24807670 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041130 (Zfp598) NM_183149 zinc finger protein 598 Gene [Source:MGI Symbol;Acc:MGI:2670965]

 
Come back to gene ENSMUSG00000041130


For any suggestions or comments, please send an email to unitrap@crg.es