Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XA052
Clone ID XA052
Vector pGT0pfs
Project baygenomics

Sequence tag XA052
Sequence
TTCAATATGGCGGCGCCCAGTGGCAGTGTGAACTGTGAAGAGTTCGCCGAGTTCCAGGAATTACTCAAGGTGATGAGGAC
AATTGATGACAGAATAGTACATGAATTAAACACTACGGTTCCAACAGCTTCCTTTGCAGGGAAAATCGATGCCAGCCAAA
CCTGTAAACAGCTGTATGAGTCTTTGATGGCAGCTCATGTCAGTAGGGACAGAGTTATAAAGAACTGTATAGCCCAGACC
TCAGCAGTAGTAAAAAGTCTCCGAGAAGAGAGAGAAAAGAACCTGGATGACTTAACGTTATTAAAGCGACTTAGAAAAGA
ACAGACAA
Sequence Type mRNA
Unitrap ID UNI10335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36072167..36085247 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]

 
Come back to gene ENSMUSG00000075229


For any suggestions or comments, please send an email to unitrap@crg.es