Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E061H04
Clone ID E061H04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE061H04
Sequence
TTTAAAGTGGCTAGCTATGACTAGGGGCTGGCACGCAGGCATTTGTAATACTGCTAGTGCTTCTCATCGGTGGTGTAGCT
TCAGAGGCGGGAGAGATTTGTGCTATTTTGGGTATCTGCTATTCTGCTGCTGTTATCCTGCTGTAGACTGCATAAAATTC
TAGAGCTGAAATGAGATTAAGATTTCAATTTATTTACAAATTTACCTTCTCTGTTTTGAACGTTTGCTCCTGATACTGTG
TCGGGGACTTCACATACACNNNNNTNTTTTACCCTGCCAAAATCCTAGTGCTGTAAGTAC
Sequence Type genomic DNA
Unitrap ID UNI10917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89519947..89520246 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027951 (Adar) NM_001038587 adenosine deaminase, RNA-specific Gene [Source:MGI (curated);Acc:Adar-005]

 
Come back to gene ENSMUSG00000027951


For any suggestions or comments, please send an email to unitrap@crg.es