Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E061D12
Clone ID E061D12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE061D12
Sequence
GATCTATCCGAAAGGGGGCAAGTGCTTCTCCAATGCAGAGTTTATGATTGTTCGTTCGGGACCGTTGCGAGTGTGGTTGT
GTAGCTGTGTA
Sequence Type genomic DNA
Unitrap ID UNI10652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126142710..126142800 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]


SPLK-Sequence tag 3SE061D12
Sequence
GTGTACTCTTGTGGTGTGCCTATGAGTAGACTTGGTCATTCATTTCATATGGGTATACTAAGTACCTGTCTTTGTGCCCG
GCATTAGCTTGAGCTGTGACTAGGTCAAGTATGGTCCTCTTTTTGAAACACTGAGCTGAGGATGGTGAGTGTATGTGCAA
CAGTAAACTTTAAAGAGCTAGGATGTGAGAGGGGTGTTTGTTAGTGGGCTTGTGCGCAGTGTCCGCTCAGCTCTTTCTGG
GATAGGTGTGACTAGTTTAGTTCCTTTGCCGCTGAGTTCTTTGGGCTGGACTTGCATGCTCCTCTGTGGAAAGGGGCTGG
GGCTGATTTGACAGGTGGTTAGAGGGAGTCAAGTCCTTCAGCTTTGGAAAGTGTGCACCTCCCACAAAATGGTGCTCTTC
CTGA
Sequence Type genomic DNA
Unitrap ID UNI10652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126142311..126142714 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es