Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E061D02
Clone ID E061D02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE061D02
Sequence
GGATCCAGCCATCCCCCGGCGTTGATGAGGTGGGTGGCTAAACACTGGGAAATCCCACTGTGAGTGGGGTGACTGGGGAG
CAAAACTTTACATTGGCCACTGCCCTCACTAGTCTACCTCTGCTCTCTATGAAGCTCTTGTCCCTTCCCCCTTCCCAGCC
TTCTCCAGCACTGAGAGAACAGTTCCAAGCACCTGATTGGAGGGGAAGGGGCTACTAGCATCCTGTGGGAAGGTGACTGA
CAGCTGCTGGAACCCATGGGCTTTCACAAAGAGGGTGGGACTTCCGGGTTGCTCTGGGCCTGGCTCCTTCAGCACTCCAC
CTCATTCCCCCAAATCTCCATCCCTGTTGCTGCCAGATTTACCTCTGGGACAAGAACAGA
Sequence Type genomic DNA
Unitrap ID UNI3694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56220582..56220961 380
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002833 (Hdgfrp2) NM_008233 hepatoma-derived growth factor, related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1194492]

 
Come back to gene ENSMUSG00000002833


For any suggestions or comments, please send an email to unitrap@crg.es