Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E061A09
Clone ID E061A09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE061A09
Sequence
AAAGCTTGCCATTTAAAGTACTAAAGAGATAGGAGCTGGCCATTCATCCTTTTGTCTAGCTAATGAGTATGTGGAGAGTC
CTCTCAAGGCCCAGCACTGTTGAAGT
Sequence Type genomic DNA
Unitrap ID UNI2631

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4543536..4543641 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020412 (Ascc2) NM_029291 activating signal cointegrator 1 complex subunit 2 Gene [Source:MGI (curated);Acc:Ascc2-001]

 
Come back to gene ENSMUSG00000020412


For any suggestions or comments, please send an email to unitrap@crg.es