Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E060G11
Clone ID E060G11
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE060G11
Sequence
TGGTCAGAGTGTTGTGATTTCCTGGCATTTGTTGTTCTTCATAACCCAGTCAGCAGCTGAATGCCTCCCCACCCGCTTTG
TAACAATATGAGCTTCTTAGTCTGGCCCTNNNNNAGATGAAATGAACTTCAACAGATTAATTGTATTGTGACAGTATATG
TGCCCAAGGAGGGAATTTCTTGAATCCAGGCAACTGTGGACCTCAGAAGGGAAAGAAGTAGTGGTTGCAGTTTAACATGT
GCGCTGTCTCTGCTTTTGTCTCACTAGGGAAACCACTTTCAGGCCAAT
Sequence Type genomic DNA
Unitrap ID UNI29812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93242540..93242827 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]


SPLK-Sequence tag 3SE060G11
Sequence
AGGTTTCTAATGAAGGCAGGTTCTCTGTGAAAGGCATGTTCTCTTGCCTACTCTGGCCCTTCTCTCTTGTGTAAAATTTA
AGCAGCGGATATTTATGGAGCGACGCGACTGCCACGTGTCCCGTTGTCTTTCTAGATACTGGATTTAGAGTTGTGAGCAC
AAGTGACCATTCTGGTCAAGGATCACAGATAATG
Sequence Type genomic DNA
Unitrap ID UNI29812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93243110..93243303 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es