Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E060A09
Clone ID E060A09
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE060A09
Sequence
AGGTGCTGCCTGCGGCTTCCTAGTCCGGGCCGCTCTTCTGCCTTGCGTAGCGCTGCGGTGGAGGGGAAGGAGCCAACCCC
TCCCCCTGCAGCCGCCACTTCCTTTGTTGTTGCTTTTGTCTCACGCCGAGCACATGGTCCGGG
Sequence Type genomic DNA
Unitrap ID UNI22489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54788573..54788715 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034928 (Rnf44) NP_598825 ring finger protein 44 Gene [Source:MGI Symbol;Acc:MGI:2145310]

 
Come back to gene ENSMUSG00000034928


For any suggestions or comments, please send an email to unitrap@crg.es