Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XA129
Clone ID XA129
Vector pGT0pfs
Project baygenomics

Sequence tag XA129
Sequence
AGACCCATTTCCCGCCTTCACAGACCTAATCAAGAAATGGAAACTGAACCAGTTTCCGTGCAGA
Sequence Type mRNA
Unitrap ID UNI10340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58097470..58097533 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es