Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E059G03
Clone ID E059G03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE059G03
Sequence
GTTTATTTTTAGAGAAAATTGTTTCCATAAAGAGGAAGGCTTCTCAGAACTTGTATCCTCACCACTTTCCCGACCCTCCA
CAAGGGCCTGGACTGGCTCTCTGCTTTGAGGTCGCCGAGGGGTCCCACCTCCATGTTGTCCCTTACCCCCCTCTGCAACC
CCACTGGAGTGTCCCTGTTAGCACCCTGGCCCTCCACCAGGCCT
Sequence Type genomic DNA
Unitrap ID UNI10883

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21600954..21601157 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es