Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E059A04
Clone ID E059A04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE059A04
Sequence
GGGTCCCCAGCTTCTCTTTTCAAACTTGTCTTTTTTCACACACGAGCTCTCCAGCCTTGTAAAAGGTTCCTCTCAGGCTT
CGTTCTGTGCACTGGCAGACAGTCTTAAGTCTTAGAAAGTGAAGCATCTGTCACATGGGGGTTTGGCCAAATCCAAATTA
CTTGGCCTTGAGCTTAGAACTTGAGTCTTTACGATTTCTTGCTATGAATGAGGGTCACAGGGAAGACTCTTGGAAGCCAG
CCTTCTTGGTTTCTTAGCTTGAAGTATCACACCTTAGTGGAGATTTTCACTAGAGG
Sequence Type genomic DNA
Unitrap ID UNI14831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102177363..102177658 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es