Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E058H07
Clone ID E058H07
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE058H07
Sequence
TATGCCCATTTTTCTGAAGGTGGGTAGAAAAGTGCTCTGAGCTGGGATGGTGAAAAAGAGCTTTTGTGGCCCTTTGCTCA
GAGCTAAGAAGAGAGTGTTACAGATTTGGGGGAGCAGTAACCCAAGCCTTGTTTAAAGGATGCTGAGAATGGAGCCTAAC
TATAGGGCAGGATCAAATGACTTTATTCGGGCTTATGAATCTTGGCTTTCTTCATTTTTATGCCAGACAGTATGACCCGA
AGATTGAAAAATGAAAATTTCTTCTGGGACTTAGGGCTTATTGTTAATACTACCAGGAATGAATTGATTCTTTAGCCTCA
CTGTGGAAACATGAACTGCTTGTTG
Sequence Type genomic DNA
Unitrap ID UNI15801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107758813..107759157 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]


SPLK-Sequence tag 3SE058H07
Sequence
GTTGATGTGTAGGGTATCTTAATTGGCATTGGCATTGGCATGCAGTTTGCCAGCACCTGTTCAGTCCAGGATGTTTTTAA
TACACTCTGTTTCAAACGCCTGCACTGCACAGGTTAGTCATGTGACAGACTCATGCCTCAGAGTCATGGGGTTAAATGGA
ACACCAGTACTGTTTTCCTGCTTAGGTTATGAAGTAGTCCTTCCAAATGCTGACATGCTTGTAGCTCCTGTCATCTAATC
ACAAGTGAGCTACTGAGAAGAAAAAATAGGACATGGAGAGGATTTTCTTGGAGGAGTTCCTTCTGGGAGGTCATTGGCCA
GCCATAGTTGTAATTGCCAGATAAAGAATGCCAG
Sequence Type genomic DNA
Unitrap ID UNI15801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107759154..107759507 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es